Transcript: Human NM_021143.4

Homo sapiens zinc finger protein 20 (ZNF20), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
ZNF20 (7568)
Length:
3004
CDS:
169..1767

Additional Resources:

NCBI RefSeq record:
NM_021143.4
NBCI Gene record:
ZNF20 (7568)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021143.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235719 ACTTGGATGGTTTCGTAATAC pLKO_005 1917 3UTR 100% 13.200 6.600 Y ZNF20 n/a
2 TRCN0000235721 CAGTTCCATTCAGTATCATAA pLKO_005 1053 CDS 100% 13.200 6.600 Y ZNF20 n/a
3 TRCN0000014808 CCTGATTCTTTGGCTTGTTAA pLKO.1 2059 3UTR 100% 13.200 6.600 Y ZNF20 n/a
4 TRCN0000244329 TAGTGAAATTCGTAGACATAA pLKO_005 969 CDS 100% 13.200 6.600 Y ZNF20 n/a
5 TRCN0000235718 AGGAGTGAATGCCGATGAATG pLKO_005 918 CDS 100% 10.800 5.400 Y ZNF20 n/a
6 TRCN0000235720 TTTCCAATTACATTCGATATC pLKO_005 1634 CDS 100% 10.800 5.400 Y ZNF20 n/a
7 TRCN0000014811 CAGGAGTGAATGCCGATGAAT pLKO.1 917 CDS 100% 5.625 2.813 Y ZNF20 n/a
8 TRCN0000014809 CGGACCTTCAAAGGCATGAAA pLKO.1 1223 CDS 100% 5.625 2.813 Y ZNF20 n/a
9 TRCN0000014812 CTGGAATAACACCATGTGAAA pLKO.1 467 CDS 100% 4.950 2.475 Y ZNF20 n/a
10 TRCN0000014810 GCACGGGTCATTCATCTCTTA pLKO.1 509 CDS 100% 4.950 2.475 Y ZNF20 n/a
11 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1086 CDS 100% 13.200 6.600 Y Zfp977 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021143.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.