Transcript: Human NM_021161.4

Homo sapiens potassium two pore domain channel subfamily K member 10 (KCNK10), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-07
Taxon:
Homo sapiens (human)
Gene:
KCNK10 (54207)
Length:
7518
CDS:
458..2074

Additional Resources:

NCBI RefSeq record:
NM_021161.4
NBCI Gene record:
KCNK10 (54207)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021161.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433339 CAATTATCGGGAGTGGTATAA pLKO_005 1327 CDS 100% 13.200 18.480 N KCNK10 n/a
2 TRCN0000416674 ATGCGGGAGTCAGTCCAATAG pLKO_005 864 CDS 100% 10.800 15.120 N KCNK10 n/a
3 TRCN0000044578 CCGGAGAACAACTCATTACTT pLKO.1 2039 CDS 100% 5.625 7.875 N KCNK10 n/a
4 TRCN0000044580 GCCTTGGAGTCCATTTACTTT pLKO.1 1244 CDS 100% 5.625 3.938 N KCNK10 n/a
5 TRCN0000044581 GCTGGAATTGGAGACCAACTT pLKO.1 1055 CDS 100% 4.950 3.465 N KCNK10 n/a
6 TRCN0000044582 GTCCTCAGTATGATCGGAGAT pLKO.1 1397 CDS 100% 4.050 2.835 N KCNK10 n/a
7 TRCN0000044579 CCAGAAGAATACCATCGCCTT pLKO.1 757 CDS 100% 2.160 1.296 N KCNK10 n/a
8 TRCN0000125693 CCCACTCACTGGACATGCTAT pLKO.1 1614 CDS 100% 4.950 2.970 N Kcnk10 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6169 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021161.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.