Transcript: Human NM_021205.6

Homo sapiens ras homolog family member U (RHOU), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
RHOU (58480)
Length:
3965
CDS:
265..1041

Additional Resources:

NCBI RefSeq record:
NM_021205.6
NBCI Gene record:
RHOU (58480)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021205.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414240 CATCGTCGCTGGCATTCAATA pLKO_005 918 CDS 100% 13.200 18.480 N RHOU n/a
2 TRCN0000412393 TTTACTGCGTAGAACCTATAT pLKO_005 1117 3UTR 100% 13.200 18.480 N RHOU n/a
3 TRCN0000440900 TAAGCTGTGCGCCGAGGAAAT pLKO_005 828 CDS 100% 10.800 15.120 N RHOU n/a
4 TRCN0000048654 CAGTCGGATCTCAGAGAAGAT pLKO.1 748 CDS 100% 4.950 3.465 N RHOU n/a
5 TRCN0000048653 CGGACAGGATGAATTTGACAA pLKO.1 579 CDS 100% 4.950 3.465 N RHOU n/a
6 TRCN0000048657 CTACACCAACACAGACATCTT pLKO.1 615 CDS 100% 4.950 3.465 N RHOU n/a
7 TRCN0000077507 CTGCTACACCAACACAGACAT pLKO.1 612 CDS 100% 4.950 3.465 N Rhou n/a
8 TRCN0000287361 CTGCTACACCAACACAGACAT pLKO_005 612 CDS 100% 4.950 3.465 N Rhou n/a
9 TRCN0000048655 GCAACAGCCAAAGAAGTCTAA pLKO.1 951 CDS 100% 4.950 3.465 N RHOU n/a
10 TRCN0000048656 CTACATCGAGTGTTCAGCCTT pLKO.1 861 CDS 100% 2.640 1.848 N RHOU n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021205.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.