Transcript: Human NM_021240.4

Homo sapiens doublesex and mab-3 related transcription factor 3 (DMRT3), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
DMRT3 (58524)
Length:
2493
CDS:
348..1766

Additional Resources:

NCBI RefSeq record:
NM_021240.4
NBCI Gene record:
DMRT3 (58524)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021240.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412573 TTTACACCGAGGACGACTATG pLKO_005 1696 CDS 100% 10.800 15.120 N DMRT3 n/a
2 TRCN0000017902 ACAGAGGTCTTCAGTGACAAA pLKO.1 846 CDS 100% 4.950 6.930 N DMRT3 n/a
3 TRCN0000017900 CAAGCGTTACTGCCGCTTCAA pLKO.1 479 CDS 100% 0.495 0.693 N DMRT3 n/a
4 TRCN0000414566 GACTATAAACAGGGACATTAT pLKO_005 2194 3UTR 100% 13.200 9.240 N DMRT3 n/a
5 TRCN0000017898 CCTGATGATGGGTGTCCATTT pLKO.1 1659 CDS 100% 10.800 7.560 N DMRT3 n/a
6 TRCN0000017901 CTCAGACTCTAGAACACTCAA pLKO.1 1733 CDS 100% 4.950 3.465 N DMRT3 n/a
7 TRCN0000017899 GCACATCTTTGAACACACCTT pLKO.1 1280 CDS 100% 2.640 1.848 N DMRT3 n/a
8 TRCN0000433741 AGGTCAGCCTTGCACCTAAAC pLKO_005 2070 3UTR 100% 10.800 6.480 N DMRT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021240.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.