Transcript: Mouse NM_021288.4

Mus musculus thymidylate synthase (Tyms), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tyms (22171)
Length:
3798
CDS:
79..1002

Additional Resources:

NCBI RefSeq record:
NM_021288.4
NBCI Gene record:
Tyms (22171)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021288.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313922 CACCTCCAAGAGTAGCCATTA pLKO_005 1399 3UTR 100% 10.800 8.640 N Tyms n/a
2 TRCN0000075938 CCTGAGCTATTCTATCTCATT pLKO.1 2591 3UTR 100% 4.950 3.465 N Tyms n/a
3 TRCN0000045667 CTTTGGGAGATGCACATATTT pLKO.1 812 CDS 100% 15.000 9.000 N TYMS n/a
4 TRCN0000075942 CAGAGTACAAAGATATGGATT pLKO.1 491 CDS 100% 4.950 2.970 N Tyms n/a
5 TRCN0000317583 CAGAGTACAAAGATATGGATT pLKO_005 491 CDS 100% 4.950 2.970 N Tyms n/a
6 TRCN0000075940 GCTCACAACCAAACGAGTGTT pLKO.1 279 CDS 100% 4.950 2.970 N Tyms n/a
7 TRCN0000317506 GCTCACAACCAAACGAGTGTT pLKO_005 279 CDS 100% 4.950 2.970 N Tyms n/a
8 TRCN0000075941 GCACATATTTACCTGAATCAT pLKO.1 823 CDS 100% 5.625 2.813 Y Tyms n/a
9 TRCN0000349520 GCACATATTTACCTGAATCAT pLKO_005 823 CDS 100% 5.625 2.813 Y Tyms n/a
10 TRCN0000075939 CCCTTCAACATTGCCAGCTAT pLKO.1 730 CDS 100% 4.950 2.475 Y Tyms n/a
11 TRCN0000317508 CCCTTCAACATTGCCAGCTAT pLKO_005 730 CDS 100% 4.950 2.475 Y Tyms n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021288.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.