Transcript: Mouse NM_021312.5

Mus musculus WD repeat domain 12 (Wdr12), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Wdr12 (57750)
Length:
2946
CDS:
361..1632

Additional Resources:

NCBI RefSeq record:
NM_021312.5
NBCI Gene record:
Wdr12 (57750)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021312.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125625 CCCGAACTAAAGATGGTTCTT pLKO.1 1337 CDS 100% 4.950 6.930 N Wdr12 n/a
2 TRCN0000328530 CTTAGTGTCTCACTGTTATTT pLKO_005 1680 3UTR 100% 15.000 10.500 N Wdr12 n/a
3 TRCN0000328589 TTTGTCCTTCGTGCTTATAAA pLKO_005 2060 3UTR 100% 15.000 10.500 N Wdr12 n/a
4 TRCN0000125627 CCTGTCTGGTTCTTATGATAA pLKO.1 702 CDS 100% 13.200 9.240 N Wdr12 n/a
5 TRCN0000328529 TGCTGTATAGTGAGCTTAAAG pLKO_005 1890 3UTR 100% 13.200 9.240 N Wdr12 n/a
6 TRCN0000328588 GATAATCCTCTGATATCATTG pLKO_005 1963 3UTR 100% 10.800 7.560 N Wdr12 n/a
7 TRCN0000328590 TTGGATAACAGTTCATCTTTC pLKO_005 2017 3UTR 100% 10.800 7.560 N Wdr12 n/a
8 TRCN0000125626 CGAGTTTGATTTCCTTATCAA pLKO.1 513 CDS 100% 0.563 0.394 N Wdr12 n/a
9 TRCN0000125628 CCTACAGATGAAGAAGATGAA pLKO.1 1018 CDS 100% 4.950 2.970 N Wdr12 n/a
10 TRCN0000125624 GCTGGTAGAATGCTTGCCTAA pLKO.1 1745 3UTR 100% 4.050 2.430 N Wdr12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021312.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.