Transcript: Mouse NM_021381.3

Mus musculus prokineticin receptor 1 (Prokr1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Prokr1 (58182)
Length:
4073
CDS:
247..1428

Additional Resources:

NCBI RefSeq record:
NM_021381.3
NBCI Gene record:
Prokr1 (58182)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021381.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028669 CAGTTCTACTACAGGTCCTAT pLKO.1 922 CDS 100% 4.950 6.930 N Prokr1 n/a
2 TRCN0000028711 CCTCTGTCAACTACTTGCGTA pLKO.1 659 CDS 100% 2.640 2.112 N Prokr1 n/a
3 TRCN0000028748 CAGGAATAACACCAGTAAGTA pLKO.1 1281 CDS 100% 5.625 3.938 N Prokr1 n/a
4 TRCN0000028687 CGGCTCGTTACCATTCACTTT pLKO.1 336 CDS 100% 4.950 3.465 N Prokr1 n/a
5 TRCN0000028684 GTGGTCAGTATCCATCCTCAT pLKO.1 804 CDS 100% 4.050 2.835 N Prokr1 n/a
6 TRCN0000357322 CCTTTGAGATGGACTACTATG pLKO_005 596 CDS 100% 10.800 6.480 N PROKR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021381.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.