Transcript: Mouse NM_021384.4

Mus musculus radical S-adenosyl methionine domain containing 2 (Rsad2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Rsad2 (58185)
Length:
3785
CDS:
34..1122

Additional Resources:

NCBI RefSeq record:
NM_021384.4
NBCI Gene record:
Rsad2 (58185)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021384.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365846 CTCGTCAGTGCAACTACAAAT pLKO_005 275 CDS 100% 13.200 18.480 N Rsad2 n/a
2 TRCN0000077449 CGTGAGTGTCAACTACCACTT pLKO.1 252 CDS 100% 4.050 5.670 N Rsad2 n/a
3 TRCN0000077448 CCCTTGAGAAACTGGGTTATT pLKO.1 1430 3UTR 100% 13.200 9.240 N Rsad2 n/a
4 TRCN0000365918 GCTTCGATGAGCAGGTTAATG pLKO_005 581 CDS 100% 13.200 9.240 N Rsad2 n/a
5 TRCN0000374020 AGGACCCTTCCAAGTCTATTC pLKO_005 989 CDS 100% 10.800 7.560 N Rsad2 n/a
6 TRCN0000365919 GATGAAAGACTCCTACCTTAT pLKO_005 924 CDS 100% 10.800 7.560 N Rsad2 n/a
7 TRCN0000056671 GCCTGAATCTAACCAGAAGAT pLKO.1 906 CDS 100% 4.950 3.465 N RSAD2 n/a
8 TRCN0000077450 CAGGGATTACAAGGTGGCTTT pLKO.1 669 CDS 100% 4.050 2.835 N Rsad2 n/a
9 TRCN0000222745 GTGGAGTAAAGCTGACCTGAA pLKO.1 1089 CDS 100% 4.050 2.835 N Rsad2 n/a
10 TRCN0000374019 AGATCAACTCTGTCATTAATC pLKO_005 692 CDS 100% 13.200 7.920 N Rsad2 n/a
11 TRCN0000077451 CCTACCTTATCCTAGATGAAT pLKO.1 935 CDS 100% 5.625 3.375 N Rsad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021384.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.