Transcript: Mouse NM_021394.2

Mus musculus Z-DNA binding protein 1 (Zbp1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Zbp1 (58203)
Length:
1988
CDS:
148..1383

Additional Resources:

NCBI RefSeq record:
NM_021394.2
NBCI Gene record:
Zbp1 (58203)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021394.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436523 TCCGCATATCCATGTAGATTG pLKO_005 1530 3UTR 100% 10.800 15.120 N Zbp1 n/a
2 TRCN0000077358 GCTCCTAGACTTTAGATAGAT pLKO.1 1747 3UTR 100% 5.625 7.875 N Zbp1 n/a
3 TRCN0000077360 CCTAGCCTTGATGAAAGAATA pLKO.1 409 CDS 100% 13.200 9.240 N Zbp1 n/a
4 TRCN0000077359 GCGATTATTTGTCAGCACAAT pLKO.1 637 CDS 100% 4.950 3.465 N Zbp1 n/a
5 TRCN0000077361 CCTGTATTCCATGAGAAATAA pLKO.1 519 CDS 100% 15.000 9.000 N Zbp1 n/a
6 TRCN0000077362 GTCCAGACAGTCCACATCAAA pLKO.1 1057 CDS 100% 5.625 3.375 N Zbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021394.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.