Transcript: Mouse NM_021419.2

Mus musculus ring finger protein 8 (Rnf8), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Rnf8 (58230)
Length:
2096
CDS:
180..1646

Additional Resources:

NCBI RefSeq record:
NM_021419.2
NBCI Gene record:
Rnf8 (58230)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021419.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039432 GCTCTAATGGAAGAACTAAAT pLKO.1 1233 CDS 100% 13.200 6.600 Y Rnf8 n/a
2 TRCN0000039431 ACAGGGTTATTGCATCCGTAA pLKO.1 464 CDS 100% 4.050 2.025 Y Rnf8 n/a
3 TRCN0000039429 CGGAAAGTAGAGTGTCCCATT pLKO.1 1485 CDS 100% 4.050 2.025 Y Rnf8 n/a
4 TRCN0000039433 CTGGCTAATGTCGCCAGTAAA pLKO.1 705 CDS 100% 1.320 0.660 Y Rnf8 n/a
5 TRCN0000039430 GCTCGAGAACTAAGAGGAAAT pLKO.1 625 CDS 100% 0.000 0.000 Y Rnf8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021419.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.