Transcript: Mouse NM_021456.4

Mus musculus carboxylesterase 1G (Ces1g), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Ces1g (12623)
Length:
2289
CDS:
56..1753

Additional Resources:

NCBI RefSeq record:
NM_021456.4
NBCI Gene record:
Ces1g (12623)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021456.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031773 ACCCTCCTTTGTGCTACCAAA pLKO.1 303 CDS 100% 4.950 3.465 N Ces1g n/a
2 TRCN0000334416 ACCCTCCTTTGTGCTACCAAA pLKO_005 303 CDS 100% 4.950 3.465 N Ces1g n/a
3 TRCN0000031769 CCAATTCTTAACATCTCTGAA pLKO.1 1208 CDS 100% 4.950 3.465 N Ces1g n/a
4 TRCN0000031770 GACTTGTGATAGATGGAGCAT pLKO.1 483 CDS 100% 2.640 1.848 N Ces1g n/a
5 TRCN0000334339 GACTTGTGATAGATGGAGCAT pLKO_005 483 CDS 100% 2.640 1.848 N Ces1g n/a
6 TRCN0000031771 CATCTGTAATCGTGTCCCGTA pLKO.1 1335 CDS 100% 2.160 1.512 N Ces1g n/a
7 TRCN0000348249 CCAACCAAAGGAAGATCATTC pLKO_005 360 CDS 100% 10.800 6.480 N Ces1g n/a
8 TRCN0000031772 CTCTTGGAGGTCTCACTGAAA pLKO.1 932 CDS 100% 4.950 2.970 N Ces1g n/a
9 TRCN0000334340 CTCTTGGAGGTCTCACTGAAA pLKO_005 932 CDS 100% 4.950 2.970 N Ces1g n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021456.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.