Transcript: Mouse NM_021532.4

Mus musculus dishevelled-binding antagonist of beta-catenin 1 (Dact1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dact1 (59036)
Length:
3650
CDS:
101..2437

Additional Resources:

NCBI RefSeq record:
NM_021532.4
NBCI Gene record:
Dact1 (59036)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021532.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109380 CGGGCAGTAGTGTGAACTTTA pLKO.1 1125 CDS 100% 13.200 18.480 N Dact1 n/a
2 TRCN0000109381 CGACTCGGATACAAATAAGAA pLKO.1 1771 CDS 100% 5.625 7.875 N Dact1 n/a
3 TRCN0000109382 GCGAAGGCAGTTGAATTGTTT pLKO.1 412 CDS 100% 5.625 4.500 N Dact1 n/a
4 TRCN0000313908 TGCAGATGTGAATCCTAAATA pLKO_005 709 CDS 100% 15.000 10.500 N Dact1 n/a
5 TRCN0000313976 CCAGACGACTCGGATACAAAT pLKO_005 1766 CDS 100% 13.200 9.240 N Dact1 n/a
6 TRCN0000376880 CTGCCATCTCCAAGCAGTTTG pLKO_005 926 CDS 100% 10.800 7.560 N Dact1 n/a
7 TRCN0000109383 ACCAGTGTGATCTTGTGTCTA pLKO.1 729 CDS 100% 4.950 3.465 N Dact1 n/a
8 TRCN0000109384 GCATCTGGTGAAAGCTCAGTT pLKO.1 1585 CDS 100% 4.950 3.465 N Dact1 n/a
9 TRCN0000317492 GCATCTGGTGAAAGCTCAGTT pLKO_005 1585 CDS 100% 4.950 3.465 N Dact1 n/a
10 TRCN0000376955 TCCCATCCTGCATCCAGTAAG pLKO_005 956 CDS 100% 10.800 6.480 N Dact1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021532.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.