Transcript: Mouse NM_021543.4

Mus musculus protocadherin 8 (Pcdh8), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Pcdh8 (18530)
Length:
4003
CDS:
192..3404

Additional Resources:

NCBI RefSeq record:
NM_021543.4
NBCI Gene record:
Pcdh8 (18530)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021543.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435555 GACCGGTTTCAGTGTTGTATA pLKO_005 3465 3UTR 100% 13.200 9.240 N PCDH8 n/a
2 TRCN0000412645 TTAACCTGTACATTGTGTAAT pLKO_005 3677 3UTR 100% 13.200 9.240 N PCDH8 n/a
3 TRCN0000055863 CCGCCTGATGAAGCAATTCAA pLKO.1 380 CDS 100% 5.625 3.938 N PCDH8 n/a
4 TRCN0000094225 GCAGAAGACCTGCACATGAAA pLKO.1 339 CDS 100% 5.625 3.938 N Pcdh8 n/a
5 TRCN0000094228 CAACCGTCAGTTTCGTGGTAA pLKO.1 2302 CDS 100% 4.950 3.465 N Pcdh8 n/a
6 TRCN0000094226 GCTGATCGTCATCATCGTGTT pLKO.1 2432 CDS 100% 4.050 2.835 N Pcdh8 n/a
7 TRCN0000055866 CGCAAGAAGGAGGTGCGCAAA pLKO.1 2514 CDS 100% 1.350 0.945 N PCDH8 n/a
8 TRCN0000055864 CCAGATGTCAACCTTCTGTAA pLKO.1 3134 CDS 100% 4.950 2.970 N PCDH8 n/a
9 TRCN0000094227 CCTTGCAGCTATTTAGTCTTT pLKO.1 232 CDS 100% 4.950 3.960 N Pcdh8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021543.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.