Transcript: Human NM_021625.5

Homo sapiens transient receptor potential cation channel subfamily V member 4 (TRPV4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
TRPV4 (59341)
Length:
3228
CDS:
81..2696

Additional Resources:

NCBI RefSeq record:
NM_021625.5
NBCI Gene record:
TRPV4 (59341)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021625.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420359 CCCGTGAGAACACCAAGTTTG pLKO_005 1084 CDS 100% 10.800 15.120 N TRPV4 n/a
2 TRCN0000045041 CTGTTTGACTACGGCACCTAT pLKO.1 399 CDS 100% 4.950 6.930 N TRPV4 n/a
3 TRCN0000045042 CGCTGCAAACACTACGTGGAA pLKO.1 825 CDS 100% 2.640 3.696 N TRPV4 n/a
4 TRCN0000430717 TGCTCCTATGGAGTCACATAA pLKO_005 2899 3UTR 100% 13.200 10.560 N TRPV4 n/a
5 TRCN0000045038 GCCAGTGTATTCCTCGCTTTA pLKO.1 1316 CDS 100% 10.800 7.560 N TRPV4 n/a
6 TRCN0000416653 TTTCTAGTCCAGCCGCATTTC pLKO_005 2733 3UTR 100% 10.800 7.560 N TRPV4 n/a
7 TRCN0000045039 GCCAACATGAAGGTGTGCAAT pLKO.1 1998 CDS 100% 4.950 3.465 N TRPV4 n/a
8 TRCN0000045040 CCAGAACTTGGGCATCATCAA pLKO.1 2447 CDS 100% 4.950 2.970 N TRPV4 n/a
9 TRCN0000068619 CCCATCCTCAAAGTCTTCAAT pLKO.1 510 CDS 100% 5.625 3.938 N Trpv4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021625.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.