Transcript: Human NM_021777.4

Homo sapiens ADAM metallopeptidase domain 28 (ADAM28), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
ADAM28 (10863)
Length:
2158
CDS:
111..1733

Additional Resources:

NCBI RefSeq record:
NM_021777.4
NBCI Gene record:
ADAM28 (10863)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021777.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432567 GTATTTGAGATGGCTAATTAT pLKO_005 801 CDS 100% 15.000 10.500 N ADAM28 n/a
2 TRCN0000051521 CCTGGATAATGGTGAGTTTAA pLKO.1 743 CDS 100% 13.200 9.240 N ADAM28 n/a
3 TRCN0000051522 CGTCTCAGCTATGACAAGTTT pLKO.1 1248 CDS 100% 5.625 3.938 N ADAM28 n/a
4 TRCN0000051520 GCCCACAAATTATGGATGATT pLKO.1 403 CDS 100% 5.625 3.938 N ADAM28 n/a
5 TRCN0000051519 GCCTGAAATGTGTAATGGTAA pLKO.1 1532 CDS 100% 4.950 3.465 N ADAM28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021777.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.