Transcript: Human NM_021819.3

Homo sapiens lectin, mannose binding 1 like (LMAN1L), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
LMAN1L (79748)
Length:
1750
CDS:
21..1601

Additional Resources:

NCBI RefSeq record:
NM_021819.3
NBCI Gene record:
LMAN1L (79748)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021819.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437857 ACGGCATCGGGATCTTCTTTG pLKO_005 415 CDS 100% 10.800 15.120 N LMAN1L n/a
2 TRCN0000447444 TCAGAGCACGGATCACCTACT pLKO_005 580 CDS 100% 4.050 5.670 N LMAN1L n/a
3 TRCN0000057384 CCTCTCCATGTCACTCAATAA pLKO.1 1130 CDS 100% 13.200 9.240 N LMAN1L n/a
4 TRCN0000057385 CTGTGGGCATTGAGCATCATT pLKO.1 1267 CDS 100% 5.625 3.938 N LMAN1L n/a
5 TRCN0000057387 GAGTACAAGCTCAGCTTCAAA pLKO.1 120 CDS 100% 5.625 3.938 N LMAN1L n/a
6 TRCN0000057383 CCTCATTCAGACTGTAGGCTT pLKO.1 1430 CDS 100% 2.640 1.848 N LMAN1L n/a
7 TRCN0000057386 GCCTGGGAAGTAGAGGTGCAA pLKO.1 288 CDS 100% 0.880 0.616 N LMAN1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021819.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.