Transcript: Mouse NM_021879.2

Mus musculus oculocutaneous albinism II (Oca2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Oca2 (18431)
Length:
3120
CDS:
131..2632

Additional Resources:

NCBI RefSeq record:
NM_021879.2
NBCI Gene record:
Oca2 (18431)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021879.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438116 GTCAAACCTGCTACCAGTAAC pLKO_005 245 CDS 100% 10.800 15.120 N Oca2 n/a
2 TRCN0000102116 CGTCGAACTGAAGCATGAGAT pLKO.1 1747 CDS 100% 4.950 6.930 N Oca2 n/a
3 TRCN0000426048 GAACAGACTGCCCTACTAATA pLKO_005 2231 CDS 100% 13.200 9.240 N Oca2 n/a
4 TRCN0000102115 GCAGACCAAGAGAGACTTGAT pLKO.1 2653 3UTR 100% 4.950 3.465 N Oca2 n/a
5 TRCN0000102119 GTTTGGCTCATTCCTCGTGAA pLKO.1 349 CDS 100% 4.050 2.835 N Oca2 n/a
6 TRCN0000059558 GCATTCATCTTGATCTTGGAT pLKO.1 2049 CDS 100% 3.000 2.100 N OCA2 n/a
7 TRCN0000102118 GCTGGGATTTGTCATCTCCAT pLKO.1 2002 CDS 100% 2.640 1.848 N Oca2 n/a
8 TRCN0000102117 CCAGAATTCATAGCTACTGAA pLKO.1 470 CDS 100% 0.000 0.000 N Oca2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021879.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.