Transcript: Mouse NM_021885.4

Mus musculus tubby bipartite transcription factor (Tub), mRNA.

Source:
NCBI, updated 2017-04-30
Taxon:
Mus musculus (mouse)
Gene:
Tub (22141)
Length:
5941
CDS:
222..1739

Additional Resources:

NCBI RefSeq record:
NM_021885.4
NBCI Gene record:
Tub (22141)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021885.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034505 GCGATAGCTATATCGGGAAAT pLKO.1 1192 CDS 100% 1.080 1.512 N Tub n/a
2 TRCN0000432865 AGAAGAAGGGAAAGCATAAAG pLKO_005 598 CDS 100% 13.200 9.240 N Tub n/a
3 TRCN0000444543 GCGGTGTGCTATGAGACAAAT pLKO_005 1323 CDS 100% 13.200 9.240 N Tub n/a
4 TRCN0000034508 CCTTACAGTGTCCTAGATGAT pLKO.1 252 CDS 100% 4.950 3.465 N Tub n/a
5 TRCN0000034504 GCACTCAAGCTGTATGTAGAA pLKO.1 2141 3UTR 100% 4.950 3.465 N Tub n/a
6 TRCN0000034507 CGTTTATGACAATGGCGTCAA pLKO.1 1244 CDS 100% 4.050 2.835 N Tub n/a
7 TRCN0000149281 GAATGATGACACACAGTCCTA pLKO.1 1514 CDS 100% 2.640 1.848 N TUB n/a
8 TRCN0000034506 CCAGGCATGAACATGGTTCAT pLKO.1 1386 CDS 100% 0.495 0.347 N Tub n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021885.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.