Transcript: Mouse NM_021891.3

Mus musculus fidgetin-like 1 (Fignl1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Fignl1 (60530)
Length:
2964
CDS:
199..2250

Additional Resources:

NCBI RefSeq record:
NM_021891.3
NBCI Gene record:
Fignl1 (60530)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021891.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366562 GTTCGACCAATAGCTTATATT pLKO_005 2131 CDS 100% 15.000 21.000 N Fignl1 n/a
2 TRCN0000101431 CCCAGCATACATCTAAATCTT pLKO.1 1163 CDS 100% 5.625 4.500 N Fignl1 n/a
3 TRCN0000101430 GCTGTGCTACTTGTATTGTTT pLKO.1 2315 3UTR 100% 5.625 4.500 N Fignl1 n/a
4 TRCN0000101433 GCCACAATAAAGGAAATCGTT pLKO.1 1456 CDS 100% 3.000 2.400 N Fignl1 n/a
5 TRCN0000366497 CTTGACTACTGACTGATATAT pLKO_005 2381 3UTR 100% 15.000 10.500 N Fignl1 n/a
6 TRCN0000366561 CCAGTACATTGGGACGATATT pLKO_005 1414 CDS 100% 13.200 9.240 N Fignl1 n/a
7 TRCN0000375391 GTTATCTAGTAGTCGTCTTTA pLKO_005 2275 3UTR 100% 13.200 9.240 N Fignl1 n/a
8 TRCN0000375338 CCGTGCACTACTACTGCATAT pLKO_005 321 CDS 100% 10.800 7.560 N Fignl1 n/a
9 TRCN0000101432 GCGCAGATATGACACAGCTTT pLKO.1 2039 CDS 100% 4.950 3.465 N Fignl1 n/a
10 TRCN0000101434 GCCAAGGATGGTTGAACTTAT pLKO.1 1365 CDS 100% 13.200 7.920 N Fignl1 n/a
11 TRCN0000431619 AGCCAGGAAACAGATAGTAAT pLKO_005 1938 CDS 100% 13.200 9.240 N FIGNL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021891.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.