Transcript: Human NM_021926.4

Homo sapiens ALX homeobox 4 (ALX4), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
ALX4 (60529)
Length:
5727
CDS:
78..1313

Additional Resources:

NCBI RefSeq record:
NM_021926.4
NBCI Gene record:
ALX4 (60529)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021926.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432045 CCATGAGTCAATGCTAGATTT pLKO_005 1651 3UTR 100% 13.200 18.480 N ALX4 n/a
2 TRCN0000429559 AGGTTCCCTGCTACGCTAAAG pLKO_005 529 CDS 100% 10.800 15.120 N ALX4 n/a
3 TRCN0000018167 GCAACCGCATCTTTACTTGCA pLKO.1 431 CDS 100% 2.640 3.696 N ALX4 n/a
4 TRCN0000018163 CGACAAGTTCGGCACAACTTT pLKO.1 197 CDS 100% 0.563 0.788 N ALX4 n/a
5 TRCN0000426691 TCAGCTTCGCATCCATGATAA pLKO_005 1580 3UTR 100% 13.200 9.240 N ALX4 n/a
6 TRCN0000421369 CCCACTCGACTTTCCTCTTAG pLKO_005 1385 3UTR 100% 10.800 7.560 N ALX4 n/a
7 TRCN0000018166 AGAGAGCAACAAGGGCAAGAA pLKO.1 698 CDS 100% 4.950 3.465 N ALX4 n/a
8 TRCN0000018164 GCTGAGAACTACGCCCAGATT pLKO.1 966 CDS 100% 4.950 3.465 N ALX4 n/a
9 TRCN0000427167 AGGAGCACAGTGCGGCCATTT pLKO_005 1279 CDS 100% 3.600 2.520 N ALX4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021926.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.