Transcript: Mouse NM_022017.3

Mus musculus transient receptor potential cation channel, subfamily V, member 4 (Trpv4), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Trpv4 (63873)
Length:
3247
CDS:
112..2727

Additional Resources:

NCBI RefSeq record:
NM_022017.3
NBCI Gene record:
Trpv4 (63873)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022017.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068619 CCCATCCTCAAAGTCTTCAAT pLKO.1 541 CDS 100% 5.625 3.938 N Trpv4 n/a
2 TRCN0000068618 CCCTGGCAAGAGTGAAATCTA pLKO.1 2505 CDS 100% 5.625 3.938 N Trpv4 n/a
3 TRCN0000068621 CCTGGAGACAGTTCTCAACAA pLKO.1 1194 CDS 100% 4.950 3.465 N Trpv4 n/a
4 TRCN0000068622 GAACATGCTTATCGCCCTCAT pLKO.1 2244 CDS 100% 4.050 2.835 N Trpv4 n/a
5 TRCN0000068620 CCTGTTCTTCTTTACCAGTAT pLKO.1 1677 CDS 100% 4.950 2.970 N Trpv4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022017.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.