Transcript: Human NM_022055.2

Homo sapiens potassium two pore domain channel subfamily K member 12 (KCNK12), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
KCNK12 (56660)
Length:
13564
CDS:
655..1947

Additional Resources:

NCBI RefSeq record:
NM_022055.2
NBCI Gene record:
KCNK12 (56660)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044698 CGTGGTGTCAACCATAGGTTT pLKO.1 1029 CDS 100% 4.950 6.930 N KCNK12 n/a
2 TRCN0000425674 TCATCTCCATGCGCGACCTCA pLKO_005 1757 CDS 100% 0.880 1.232 N KCNK12 n/a
3 TRCN0000044702 GTGCGTCAACACGCGCCAGAA pLKO.1 1854 CDS 100% 0.000 0.000 N KCNK12 n/a
4 TRCN0000044699 CTGCATTTACTCGCTCTTCAA pLKO.1 1521 CDS 100% 4.950 3.960 N KCNK12 n/a
5 TRCN0000438609 TACGTGGACTCGCTCTACTTC pLKO_005 1381 CDS 100% 4.950 3.465 N KCNK12 n/a
6 TRCN0000044700 GCTCGGCGTGTGCTGCATTTA pLKO.1 1509 CDS 100% 4.400 3.080 N KCNK12 n/a
7 TRCN0000044701 GTCAACCATAGGTTTCGGCAT pLKO.1 1035 CDS 100% 2.160 1.512 N KCNK12 n/a
8 TRCN0000432766 GTTCGCACCTCAACGAGGACA pLKO_005 740 CDS 100% 0.880 0.616 N KCNK12 n/a
9 TRCN0000421814 ATCTCGCTGCTGGCCTTCATC pLKO_005 1159 CDS 100% 1.650 0.990 N KCNK12 n/a
10 TRCN0000069255 CCATAGGTTTCGGCATGACAA pLKO.1 1040 CDS 100% 4.950 3.960 N Kcnk12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022055.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.