Transcript: Human NM_022117.4

Homo sapiens TSPY like 2 (TSPYL2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TSPYL2 (64061)
Length:
2815
CDS:
133..2214

Additional Resources:

NCBI RefSeq record:
NM_022117.4
NBCI Gene record:
TSPYL2 (64061)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022117.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130789 GACTTCGTACACGGGTTTAAA pLKO.1 2326 3UTR 100% 15.000 21.000 N TSPYL2 n/a
2 TRCN0000127532 CAACAACGAGACCACTGATAA pLKO.1 1596 CDS 100% 13.200 18.480 N TSPYL2 n/a
3 TRCN0000303520 CAACAACGAGACCACTGATAA pLKO_005 1596 CDS 100% 13.200 18.480 N TSPYL2 n/a
4 TRCN0000117982 CGACTTCGTACACGGGTTTAA pLKO.1 2325 3UTR 100% 13.200 18.480 N TSPYL2 n/a
5 TRCN0000349134 CGACTTCGTACACGGGTTTAA pLKO_005 2325 3UTR 100% 13.200 18.480 N TSPYL2 n/a
6 TRCN0000117985 CCACGAAACCACTGACAACAA pLKO.1 1635 CDS 100% 4.950 6.930 N TSPYL2 n/a
7 TRCN0000127950 CATATCTCCATGGGCTACAAA pLKO.1 1033 CDS 100% 5.625 4.500 N TSPYL2 n/a
8 TRCN0000303519 CATATCTCCATGGGCTACAAA pLKO_005 1033 CDS 100% 5.625 4.500 N TSPYL2 n/a
9 TRCN0000117983 CGAGAACACTTACGGCAACAA pLKO.1 1737 CDS 100% 4.950 3.960 N TSPYL2 n/a
10 TRCN0000117984 GCGATCATCATAGTGGAGGAT pLKO.1 634 CDS 100% 2.640 2.112 N TSPYL2 n/a
11 TRCN0000315832 GCGATCATCATAGTGGAGGAT pLKO_005 634 CDS 100% 2.640 2.112 N TSPYL2 n/a
12 TRCN0000369752 TGCAGGCACTGGAGGATATTC pLKO_005 779 CDS 100% 13.200 9.240 N TSPYL2 n/a
13 TRCN0000303521 CTGACTACGAGGACGTGATAG pLKO_005 1985 CDS 100% 10.800 7.560 N TSPYL2 n/a
14 TRCN0000117986 CTCAGACATTGATGAGACAAT pLKO.1 1452 CDS 100% 4.950 3.465 N TSPYL2 n/a
15 TRCN0000130233 CTCAGACATTGATGAGACAAT pLKO.1 1452 CDS 100% 4.950 3.465 N TSPYL2 n/a
16 TRCN0000129399 GCAAGTTCATCCAGATGCGAA pLKO.1 857 CDS 100% 2.640 1.848 N TSPYL2 n/a
17 TRCN0000428082 GAGGATGAGGATGAGGATGAA pLKO_005 649 CDS 100% 4.950 2.475 Y TAF7L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022117.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.