Transcript: Human NM_022122.3

Homo sapiens matrix metallopeptidase 27 (MMP27), mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
MMP27 (64066)
Length:
1876
CDS:
56..1597

Additional Resources:

NCBI RefSeq record:
NM_022122.3
NBCI Gene record:
MMP27 (64066)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022122.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052288 GCCTTGATGTTCCCAAATTAT pLKO.1 749 CDS 100% 15.000 21.000 N MMP27 n/a
2 TRCN0000424436 ACCCGAATCATGAGAACTAAT pLKO_005 1415 CDS 100% 13.200 18.480 N MMP27 n/a
3 TRCN0000052292 CCGTCTGTGATAAGACCACAA pLKO.1 1191 CDS 100% 4.050 5.670 N MMP27 n/a
4 TRCN0000052290 CGTGGATCAAAGCAATTTGAA pLKO.1 1370 CDS 100% 0.563 0.788 N MMP27 n/a
5 TRCN0000433491 CACCTATGGAGGATCTATTAT pLKO_005 959 CDS 100% 15.000 12.000 N MMP27 n/a
6 TRCN0000052291 CCAGTTCTACTCTCTTGAAAT pLKO.1 169 CDS 100% 13.200 9.240 N MMP27 n/a
7 TRCN0000052289 GCAGAGAAGTAATGTTCTTTA pLKO.1 930 CDS 100% 13.200 9.240 N MMP27 n/a
8 TRCN0000429521 ATAAACTATACTCCGGATATG pLKO_005 401 CDS 100% 10.800 7.560 N MMP27 n/a
9 TRCN0000087682 CAATGATCAAACAGCCTTGAT pLKO.1 736 CDS 100% 0.495 0.347 N Mmp27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022122.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.