Transcript: Mouse NM_022312.3

Mus musculus tenascin R (Tnr), mRNA.

Source:
NCBI, updated 2019-09-17
Taxon:
Mus musculus (mouse)
Gene:
Tnr (21960)
Length:
5395
CDS:
610..4686

Additional Resources:

NCBI RefSeq record:
NM_022312.3
NBCI Gene record:
Tnr (21960)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022312.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110747 GCAGATTATCGTGTTGGCTTT pLKO.1 4192 CDS 100% 4.050 5.670 N Tnr n/a
2 TRCN0000110746 GCCAAAGTTGATTTCATTCTT pLKO.1 2194 CDS 100% 5.625 4.500 N Tnr n/a
3 TRCN0000416615 CCGATGGCAGTGACGGAATAT pLKO_005 1654 CDS 100% 13.200 9.240 N TNR n/a
4 TRCN0000110745 CTTCACAACATATTCAGACTA pLKO.1 4782 3UTR 100% 4.950 3.465 N Tnr n/a
5 TRCN0000110748 CCAATGAGAGTGAAGCCTCAA pLKO.1 2348 CDS 100% 4.050 2.835 N Tnr n/a
6 TRCN0000110749 CCAAGAATTTGCGAGTGGGTT pLKO.1 2399 CDS 100% 2.640 1.848 N Tnr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022312.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.