Transcript: Mouse NM_022317.3

Mus musculus solute carrier family 28 (sodium-coupled nucleoside transporter), member 3 (Slc28a3), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Slc28a3 (114304)
Length:
4565
CDS:
71..2182

Additional Resources:

NCBI RefSeq record:
NM_022317.3
NBCI Gene record:
Slc28a3 (114304)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022317.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427075 GAAGTGTATTGGGCGCATATA pLKO_005 1233 CDS 100% 13.200 18.480 N Slc28a3 n/a
2 TRCN0000429839 ACTACTGGTCCAACCATATTT pLKO_005 1150 CDS 100% 15.000 12.000 N Slc28a3 n/a
3 TRCN0000079315 GCAACATATTTATTGGGCAAA pLKO.1 1119 CDS 100% 4.050 3.240 N Slc28a3 n/a
4 TRCN0000412624 GAGAGGAAGTATGATACAATT pLKO_005 365 CDS 100% 13.200 9.240 N Slc28a3 n/a
5 TRCN0000079314 GCCAAATATGAACAGCGAATA pLKO.1 560 CDS 100% 10.800 7.560 N Slc28a3 n/a
6 TRCN0000079313 CCCGCTAACTTCAACATCTTA pLKO.1 2945 3UTR 100% 5.625 3.938 N Slc28a3 n/a
7 TRCN0000079317 CCAGAGGATGATAGCGAAGAT pLKO.1 323 CDS 100% 4.950 3.465 N Slc28a3 n/a
8 TRCN0000079316 GCTCATTTGTTCCTACATCTT pLKO.1 1564 CDS 100% 4.950 3.465 N Slc28a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022317.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.