Transcript: Mouse NM_022411.3

Mus musculus solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2 (Slc13a2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc13a2 (20500)
Length:
2191
CDS:
19..1779

Additional Resources:

NCBI RefSeq record:
NM_022411.3
NBCI Gene record:
Slc13a2 (20500)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022411.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070178 GCCTTCTCAATCCGCCTAATT pLKO.1 1739 CDS 100% 13.200 10.560 N Slc13a2 n/a
2 TRCN0000070179 GCCATCTTTATCAGCCTGATT pLKO.1 1123 CDS 100% 4.950 3.960 N Slc13a2 n/a
3 TRCN0000070182 GCCACTCATTGTCCAAACTAA pLKO.1 99 CDS 100% 5.625 3.938 N Slc13a2 n/a
4 TRCN0000070180 CCTGGAAGACAGTGAACGATA pLKO.1 1229 CDS 100% 4.950 3.465 N Slc13a2 n/a
5 TRCN0000070181 GCTGACTATCACATTATCCAT pLKO.1 1647 CDS 100% 3.000 1.800 N Slc13a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022411.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.