Transcript: Mouse NM_022415.3

Mus musculus prostaglandin E synthase (Ptges), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Ptges (64292)
Length:
3647
CDS:
80..541

Additional Resources:

NCBI RefSeq record:
NM_022415.3
NBCI Gene record:
Ptges (64292)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022415.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366736 TCTGATCGCCTGGATACATTT pLKO_005 370 CDS 100% 13.200 18.480 N Ptges n/a
2 TRCN0000375552 TTCTCAGACCTACCTACAATT pLKO_005 892 3UTR 100% 13.200 10.560 N Ptges n/a
3 TRCN0000366739 CTCGGCTTCGTGTACTCATTC pLKO_005 335 CDS 100% 10.800 8.640 N Ptges n/a
4 TRCN0000366668 ACGTGGAGGCCTCCAGTATTA pLKO_005 238 CDS 100% 13.200 9.240 N Ptges n/a
5 TRCN0000366738 CAGAGCCATCATCCCATATAG pLKO_005 855 3UTR 100% 13.200 9.240 N Ptges n/a
6 TRCN0000366670 CGCAACGACATGGAGACAATC pLKO_005 299 CDS 100% 10.800 7.560 N Ptges n/a
7 TRCN0000067775 ACTGCTGGTCATCAAGATGTA pLKO.1 145 CDS 100% 4.950 3.465 N Ptges n/a
8 TRCN0000067774 CCGCAACGACATGGAGACAAT pLKO.1 298 CDS 100% 4.950 3.465 N Ptges n/a
9 TRCN0000375554 ATCTGTGACCAGCAGCTGAAG pLKO_005 534 CDS 100% 4.050 2.835 N Ptges n/a
10 TRCN0000375553 CAATCTATCCTTTCCTCTTCC pLKO_005 315 CDS 100% 4.050 2.835 N Ptges n/a
11 TRCN0000067776 CCTCCAGTATTACAGGAGTGA pLKO.1 247 CDS 100% 2.640 1.848 N Ptges n/a
12 TRCN0000067773 GCCTGGATACATTTCCTCGTT pLKO.1 377 CDS 100% 2.640 1.848 N Ptges n/a
13 TRCN0000375555 CCAGATGAGGCTGCGGAAGAA pLKO_005 187 CDS 100% 1.650 1.155 N Ptges n/a
14 TRCN0000067777 CCTGGCCCAGTTCTCCTGTTT pLKO.1 475 CDS 100% 1.650 0.990 N Ptges n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022415.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.