Transcript: Human NM_022480.4

Homo sapiens kelch like family member 25 (KLHL25), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
KLHL25 (64410)
Length:
3650
CDS:
171..1940

Additional Resources:

NCBI RefSeq record:
NM_022480.4
NBCI Gene record:
KLHL25 (64410)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022480.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153720 CGAGAGAACTGCTGAACATTT pLKO.1 2976 3UTR 100% 13.200 10.560 N KLHL25 n/a
2 TRCN0000158375 CACAGTGCCCTACTCACTTAT pLKO.1 1877 CDS 100% 13.200 9.240 N KLHL25 n/a
3 TRCN0000153876 CCCTGAAACAAGTGGAGAAAT pLKO.1 1399 CDS 100% 13.200 9.240 N KLHL25 n/a
4 TRCN0000158314 CCGAGAGAACTGCTGAACATT pLKO.1 2975 3UTR 100% 5.625 3.938 N KLHL25 n/a
5 TRCN0000156936 GCCAAGCTGAAGCTCTTTGTT pLKO.1 1494 CDS 100% 5.625 3.938 N KLHL25 n/a
6 TRCN0000157246 CCAGACCTTCATGTGTGACAA pLKO.1 1076 CDS 100% 4.950 3.465 N KLHL25 n/a
7 TRCN0000152809 GCTTTAGGCAAGAGAAGAGAA pLKO.1 2099 3UTR 100% 4.950 3.465 N KLHL25 n/a
8 TRCN0000153665 CCACTTCAGATACATGGAACT pLKO.1 1849 CDS 100% 4.050 2.835 N KLHL25 n/a
9 TRCN0000156867 GTGTAAGACTCTGGACTGCTA pLKO.1 1823 CDS 100% 2.640 1.848 N KLHL25 n/a
10 TRCN0000151969 CCTGAAACAAGTGGAGAAATA pLKO.1 1400 CDS 100% 13.200 7.920 N KLHL25 n/a
11 TRCN0000152946 GACCTTCATGTGTGACAAGAT pLKO.1 1079 CDS 100% 4.950 2.970 N KLHL25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022480.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.