Transcript: Human NM_022569.3

Homo sapiens N-deacetylase and N-sulfotransferase 4 (NDST4), mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
NDST4 (64579)
Length:
3095
CDS:
424..3042

Additional Resources:

NCBI RefSeq record:
NM_022569.3
NBCI Gene record:
NDST4 (64579)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022569.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358949 ATGACCGCCTAGGGTTATATA pLKO_005 1997 CDS 100% 15.000 21.000 N NDST4 n/a
2 TRCN0000359032 GGGAGTTACACCTCGTTATAA pLKO_005 2781 CDS 100% 15.000 21.000 N NDST4 n/a
3 TRCN0000036091 CGGTCAAGATATCATAGCTAT pLKO.1 696 CDS 100% 4.950 6.930 N NDST4 n/a
4 TRCN0000036089 CGGTACAGAAAGGGCTTCATT pLKO.1 1795 CDS 100% 5.625 4.500 N NDST4 n/a
5 TRCN0000036093 GCTTACCAAGTACACAATTAA pLKO.1 935 CDS 100% 15.000 10.500 N NDST4 n/a
6 TRCN0000359034 TGGAATACAGTGTTAGTATAA pLKO_005 887 CDS 100% 13.200 9.240 N NDST4 n/a
7 TRCN0000097694 AGGCATTACTAGAGACTCAAA pLKO.1 1400 CDS 100% 4.950 3.465 N Ndst4 n/a
8 TRCN0000036090 CGAGATCATAATGTGGAACTA pLKO.1 2950 CDS 100% 4.950 3.465 N NDST4 n/a
9 TRCN0000036092 GCATCCTTCAATCATCAGCAA pLKO.1 2271 CDS 100% 2.640 1.848 N NDST4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022569.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.