Transcript: Mouse NM_022723.3

Mus musculus signal peptide, CUB domain, EGF-like 1 (Scube1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-04-23
Taxon:
Mus musculus (mouse)
Gene:
Scube1 (64706)
Length:
7842
CDS:
134..3100

Additional Resources:

NCBI RefSeq record:
NM_022723.3
NBCI Gene record:
Scube1 (64706)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022723.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368880 GTGCGTGATGGGCGCTTATAT pLKO_005 2897 CDS 100% 15.000 21.000 N Scube1 n/a
2 TRCN0000109670 CGCCTTAATAGAACATCTAAA pLKO.1 3737 3UTR 100% 13.200 18.480 N Scube1 n/a
3 TRCN0000109672 CCAAATACTACAGGACGGCAA pLKO.1 1999 CDS 100% 2.160 3.024 N Scube1 n/a
4 TRCN0000109673 CACCAGAAGTACGCCTTACAT pLKO.1 818 CDS 100% 5.625 4.500 N Scube1 n/a
5 TRCN0000417213 CCGCTCCAATGAGGGTATGAA pLKO_005 607 CDS 100% 5.625 4.500 N SCUBE1 n/a
6 TRCN0000109674 GTGTGAGAATGACTACTACAA pLKO.1 364 CDS 100% 4.950 3.960 N Scube1 n/a
7 TRCN0000362784 CCTACCCTCTGCCTCTATTTC pLKO_005 3341 3UTR 100% 13.200 9.240 N Scube1 n/a
8 TRCN0000362785 TCAACGAGTGCTTGATGAATA pLKO_005 981 CDS 100% 13.200 9.240 N Scube1 n/a
9 TRCN0000109671 CCAGATGGAAAGACATGCAAA pLKO.1 956 CDS 100% 4.950 3.465 N Scube1 n/a
10 TRCN0000056156 GAAAGACAAGAAGCTGATCAA pLKO.1 2944 CDS 100% 4.950 3.465 N SCUBE1 n/a
11 TRCN0000056153 TGTGAGAATGACTACTACAAT pLKO.1 365 CDS 100% 5.625 3.938 N SCUBE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022723.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.