Transcript: Human NM_022804.3

Homo sapiens SNRPN upstream reading frame (SNURF), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
SNURF (8926)
Length:
350
CDS:
63..278

Additional Resources:

NCBI RefSeq record:
NM_022804.3
NBCI Gene record:
SNURF (8926)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022804.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414348 AGACACCAAGAGGTGGTTAAA pLKO_005 259 CDS 100% 13.200 6.600 Y SNURF n/a
2 TRCN0000413452 GAGTAGCGAGGAATCTGATTC pLKO_005 289 3UTR 100% 10.800 5.400 Y SNURF n/a
3 TRCN0000123156 CAACCAAGAGTGTCAGTTGTA pLKO.1 164 CDS 100% 4.950 2.475 Y SNURF n/a
4 TRCN0000123158 CCTGAGACGAACTACAGAACA pLKO.1 89 CDS 100% 4.950 2.475 Y SNURF n/a
5 TRCN0000123157 CGTTCTCAGCAGCAGCAAGTA pLKO.1 192 CDS 100% 4.950 2.475 Y SNURF n/a
6 TRCN0000419956 GGTGGATTTCCAGGCTGAACT pLKO_005 218 CDS 100% 4.950 2.475 Y SNURF n/a
7 TRCN0000111934 TGAGACACCAAGAGGTGGTTA pLKO.1 257 CDS 100% 4.950 2.475 Y Snurf n/a
8 TRCN0000417704 GGTGGTTAAAGCCATATTGGA pLKO_005 270 CDS 100% 3.000 1.500 Y SNURF n/a
9 TRCN0000123154 CGAACTACAGAACAGCACGTA pLKO.1 96 CDS 100% 2.640 1.320 Y SNURF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022804.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.