Transcript: Mouse NM_022981.4

Mus musculus zinc finger protein 110 (Zfp110), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Zfp110 (65020)
Length:
3549
CDS:
392..2890

Additional Resources:

NCBI RefSeq record:
NM_022981.4
NBCI Gene record:
Zfp110 (65020)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022981.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329650 CTTCTACTGGCAACCTATATA pLKO_005 3330 3UTR 100% 15.000 21.000 N Zfp110 n/a
2 TRCN0000329648 CTCTAAAGAGAGTATACTTAT pLKO_005 1912 CDS 100% 13.200 9.240 N Zfp110 n/a
3 TRCN0000329579 GACACATGCCTTACCTGTAAA pLKO_005 2098 CDS 100% 13.200 9.240 N Zfp110 n/a
4 TRCN0000329646 AGATGTATCTCTGACGTTTAC pLKO_005 454 CDS 100% 10.800 7.560 N Zfp110 n/a
5 TRCN0000095459 GCTGAATATACCTTTGAGGAA pLKO.1 3285 3UTR 100% 2.640 1.848 N Zfp110 n/a
6 TRCN0000329580 CTGTCTTTGAAAGTATCTTAG pLKO_005 1476 CDS 100% 10.800 6.480 N Zfp110 n/a
7 TRCN0000095461 GCAGCCCAATACACGTTCAAA pLKO.1 964 CDS 100% 5.625 3.375 N Zfp110 n/a
8 TRCN0000095460 GCCCTGATTCAATCCCTCTAT pLKO.1 779 CDS 100% 4.950 2.475 Y Zfp110 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022981.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.