Transcript: Human NM_023007.2

Homo sapiens jumonji domain containing 4 (JMJD4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
JMJD4 (65094)
Length:
2612
CDS:
1..1392

Additional Resources:

NCBI RefSeq record:
NM_023007.2
NBCI Gene record:
JMJD4 (65094)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_023007.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232856 TCAACCACAACTGGGTCAATG pLKO_005 977 CDS 100% 10.800 15.120 N JMJD4 n/a
2 TRCN0000232853 ACCTACGGAGACGTGGTTGTA pLKO_005 394 CDS 100% 4.950 6.930 N JMJD4 n/a
3 TRCN0000138740 CGTGGTTGTACCAGTTGCAAA pLKO.1 405 CDS 100% 4.950 6.930 N JMJD4 n/a
4 TRCN0000232857 TCTGGTGGCTCCTCTTAATAG pLKO_005 1718 3UTR 100% 13.200 9.240 N JMJD4 n/a
5 TRCN0000232855 CCTTCAGCTGGTCTGTCAATG pLKO_005 722 CDS 100% 10.800 7.560 N JMJD4 n/a
6 TRCN0000232854 ATGTGGATGACTACCGCTTTG pLKO_005 647 CDS 100% 6.000 4.200 N JMJD4 n/a
7 TRCN0000138244 CCTCTTCACACTGGGTATGAT pLKO.1 2122 3UTR 100% 5.625 3.938 N JMJD4 n/a
8 TRCN0000138765 GAATCCCATCTGCTGCTGAAT pLKO.1 2010 3UTR 100% 4.950 3.465 N JMJD4 n/a
9 TRCN0000138689 GCACATGACTCTCAGAGACTA pLKO.1 462 CDS 100% 4.950 3.465 N JMJD4 n/a
10 TRCN0000137919 GATGTGGATGACTACCGCTTT pLKO.1 646 CDS 100% 4.050 2.835 N JMJD4 n/a
11 TRCN0000138367 CAATGTCTGTGGGAGGAAGAA pLKO.1 738 CDS 100% 4.950 2.970 N JMJD4 n/a
12 TRCN0000138555 CCTCTAGTGGATCCACAGTTT pLKO.1 2259 3UTR 100% 4.950 2.475 Y JMJD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023007.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.