Transcript: Mouse NM_023167.2

Mus musculus mitochondrial ribosomal protein L4 (Mrpl4), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mrpl4 (66163)
Length:
1312
CDS:
205..1089

Additional Resources:

NCBI RefSeq record:
NM_023167.2
NBCI Gene record:
Mrpl4 (66163)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023167.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104282 CTCAAGATACACTCCGCTCTA pLKO.1 1035 CDS 100% 4.050 5.670 N Mrpl4 n/a
2 TRCN0000323837 CTCAAGATACACTCCGCTCTA pLKO_005 1035 CDS 100% 4.050 5.670 N Mrpl4 n/a
3 TRCN0000104281 CCGTGCTCCTTGTAGACTTAA pLKO.1 848 CDS 100% 13.200 10.560 N Mrpl4 n/a
4 TRCN0000104283 TCCTACAAGTTACTACTACAT pLKO.1 675 CDS 100% 4.950 3.465 N Mrpl4 n/a
5 TRCN0000353823 TCCTACAAGTTACTACTACAT pLKO_005 675 CDS 100% 4.950 3.465 N Mrpl4 n/a
6 TRCN0000104284 CCTGACAGAGTTGGCCCAGTA pLKO.1 810 CDS 100% 1.350 0.945 N Mrpl4 n/a
7 TRCN0000323904 CCTGACAGAGTTGGCCCAGTA pLKO_005 810 CDS 100% 1.350 0.945 N Mrpl4 n/a
8 TRCN0000104280 CCTGCCCTGGTCACCTAGGGA pLKO.1 1091 3UTR 100% 0.000 0.000 N Mrpl4 n/a
9 TRCN0000323905 CCTGCCCTGGTCACCTAGGGA pLKO_005 1091 3UTR 100% 0.000 0.000 N Mrpl4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023167.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.