Transcript: Mouse NM_023224.5

Mus musculus Casitas B-lineage lymphoma c (Cblc), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cblc (80794)
Length:
1677
CDS:
28..1518

Additional Resources:

NCBI RefSeq record:
NM_023224.5
NBCI Gene record:
Cblc (80794)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023224.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112497 TCACCTACGATGAGGTCCAAA pLKO.1 749 CDS 100% 4.950 3.960 N Cblc n/a
2 TRCN0000311459 ACGTCTTCACCAGGCTCTTTC pLKO_005 659 CDS 100% 10.800 7.560 N Cblc n/a
3 TRCN0000306133 TCTGCCGTTGTGAGATCAAAG pLKO_005 1187 CDS 100% 10.800 7.560 N Cblc n/a
4 TRCN0000311456 TGGCCAATCTGGAGGTCAAAG pLKO_005 275 CDS 100% 10.800 7.560 N Cblc n/a
5 TRCN0000381958 CACCTACGATGAGGTCCAAAC pLKO_005 750 CDS 100% 6.000 4.200 N Cblc n/a
6 TRCN0000379627 ACAAACCAGGCAGCTATATCT pLKO_005 791 CDS 100% 5.625 3.938 N Cblc n/a
7 TRCN0000112498 AGGACGTGAACCAGGATGTTT pLKO.1 335 CDS 100% 5.625 3.938 N Cblc n/a
8 TRCN0000325857 AGGACGTGAACCAGGATGTTT pLKO_005 335 CDS 100% 5.625 3.938 N Cblc n/a
9 TRCN0000112495 CCTGCAAACCATTCCTCTCAA pLKO.1 876 CDS 100% 4.950 3.465 N Cblc n/a
10 TRCN0000112499 CCCTCACTACTCCCTGAAGAT pLKO.1 1339 CDS 100% 4.950 2.970 N Cblc n/a
11 TRCN0000112496 GCAAACCATTCCTCTCAACAA pLKO.1 879 CDS 100% 4.950 2.970 N Cblc n/a
12 TRCN0000325856 GCAAACCATTCCTCTCAACAA pLKO_005 879 CDS 100% 4.950 2.970 N Cblc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023224.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.