Transcript: Mouse NM_023418.2

Mus musculus phosphoglycerate mutase 1 (Pgam1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Pgam1 (18648)
Length:
1855
CDS:
178..942

Additional Resources:

NCBI RefSeq record:
NM_023418.2
NBCI Gene record:
Pgam1 (18648)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023418.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115261 CCCTAGAAGGTTGGGATCAAT pLKO.1 1452 3UTR 100% 5.625 4.500 N Pgam1 n/a
2 TRCN0000319914 CCCTAGAAGGTTGGGATCAAT pLKO_005 1452 3UTR 100% 5.625 4.500 N Pgam1 n/a
3 TRCN0000149045 GCCCTTCTGGAATGAAGAAAT pLKO.1 669 CDS 100% 13.200 9.240 N PGAM4 n/a
4 TRCN0000115264 CGTCTATGAACTGGACAAGAA pLKO.1 825 CDS 100% 4.950 3.465 N Pgam1 n/a
5 TRCN0000319843 CGTCTATGAACTGGACAAGAA pLKO_005 825 CDS 100% 4.950 3.465 N Pgam1 n/a
6 TRCN0000115262 CCCTTCTGGAATGAAGAAATT pLKO.1 670 CDS 100% 13.200 7.920 N Pgam1 n/a
7 TRCN0000319842 CCCTTCTGGAATGAAGAAATT pLKO_005 670 CDS 100% 13.200 7.920 N Pgam1 n/a
8 TRCN0000115265 CGCCTCAATGAGCGACACTAT pLKO.1 433 CDS 100% 4.950 2.970 N Pgam1 n/a
9 TRCN0000319911 CGCCTCAATGAGCGACACTAT pLKO_005 433 CDS 100% 4.950 2.970 N Pgam1 n/a
10 TRCN0000115263 CAAAGCAGAAACTGCTGCTAA pLKO.1 474 CDS 100% 0.495 0.297 N Pgam1 n/a
11 TRCN0000029470 CCCTTCTGGAATGAAGAAATA pLKO.1 670 CDS 100% 13.200 7.920 N PGAM1 n/a
12 TRCN0000330571 CCCTTCTGGAATGAAGAAATA pLKO_005 670 CDS 100% 13.200 7.920 N PGAM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023418.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.