Transcript: Mouse NM_023483.3

Mus musculus RIKEN cDNA 1110032A03 gene (1110032A03Rik), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
1110032A03Rik (68721)
Length:
1782
CDS:
254..754

Additional Resources:

NCBI RefSeq record:
NM_023483.3
NBCI Gene record:
1110032A03Rik (68721)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023483.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173207 CCAGGAAAGATACGACCTAAA pLKO.1 472 CDS 100% 10.800 15.120 N 1110032A03Rik n/a
2 TRCN0000174395 CTTATTTATGCTGATGGTCAT pLKO.1 341 CDS 100% 4.050 5.670 N 1110032A03Rik n/a
3 TRCN0000175510 CACTTCTTTATGGCCTCTAAT pLKO.1 1159 3UTR 100% 13.200 9.240 N 1110032A03Rik n/a
4 TRCN0000194534 GCACAGCGAAGTCAACTTATA pLKO.1 660 CDS 100% 13.200 9.240 N 1110032A03Rik n/a
5 TRCN0000215882 CTTGTCTGTTATCTTAGAAAC pLKO.1 305 CDS 100% 10.800 7.560 N 1110032A03Rik n/a
6 TRCN0000176429 CAACATATCTCCAGAGACAAA pLKO.1 282 CDS 100% 4.950 3.465 N 1110032A03Rik n/a
7 TRCN0000194496 GCACTTCTTTATGGCCTCTAA pLKO.1 1158 3UTR 100% 4.950 3.465 N 1110032A03Rik n/a
8 TRCN0000193176 CGAAGTCAACTTATATGACTA pLKO.1 666 CDS 100% 0.495 0.347 N 1110032A03Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023483.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.