Transcript: Mouse NM_023500.2

Mus musculus X-linked Kx blood group (Xk), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Xk (22439)
Length:
5062
CDS:
207..1547

Additional Resources:

NCBI RefSeq record:
NM_023500.2
NBCI Gene record:
Xk (22439)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023500.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173779 CCGCCTGCTCATTTACTACAT pLKO.1 1151 CDS 100% 4.950 3.960 N Xk n/a
2 TRCN0000175814 GCCTGCTCATTTACTACATGA pLKO.1 1153 CDS 100% 4.950 3.960 N Xk n/a
3 TRCN0000450274 CATCGTCCTGGTCCTCTTTAC pLKO_005 875 CDS 100% 10.800 7.560 N Xk n/a
4 TRCN0000453443 GGGACTAAGGCACGAAGTTAG pLKO_005 1606 3UTR 100% 10.800 7.560 N Xk n/a
5 TRCN0000174027 CGCCTTACGTTGCAACATCTT pLKO.1 755 CDS 100% 4.950 3.465 N Xk n/a
6 TRCN0000176321 CAGAGCAAGATGTAATGCCTA pLKO.1 1462 CDS 100% 2.640 1.848 N Xk n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4579 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023500.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.