Transcript: Mouse NM_023504.1

Mus musculus NK2 homeobox 4 (Nkx2-4), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Nkx2-4 (228731)
Length:
1065
CDS:
1..1065

Additional Resources:

NCBI RefSeq record:
NM_023504.1
NBCI Gene record:
Nkx2-4 (228731)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081689 CATCGAGGAGACCTACAAGAA pLKO.1 57 CDS 100% 4.950 3.465 N Nkx2-4 n/a
2 TRCN0000281471 CCATCGAGGAGACCTACAAGA pLKO_005 56 CDS 100% 4.950 3.465 N NKX2-4 n/a
3 TRCN0000081688 CTACTCGTCAATCTCCAGGTT pLKO.1 441 CDS 100% 2.640 1.848 N Nkx2-4 n/a
4 TRCN0000433674 TCTCCGTTTCCGACATCCTGA pLKO_005 32 CDS 100% 2.640 1.848 N Nkx2-4 n/a
5 TRCN0000081690 GCCGCCACCTACCACATGCCT pLKO.1 268 CDS 100% 0.000 0.000 N Nkx2-4 n/a
6 TRCN0000428700 TTCTCGCAAGCGCAGGTCTAC pLKO_005 583 CDS 100% 1.350 0.810 N Nkx2-4 n/a
7 TRCN0000081692 CCAGAACCATCGCTACAAGAT pLKO.1 708 CDS 100% 4.950 2.475 Y Nkx2-4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.