Transcript: Mouse NM_023514.4

Mus musculus mitochondrial ribosomal protein S9 (Mrps9), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Mrps9 (69527)
Length:
1445
CDS:
60..1232

Additional Resources:

NCBI RefSeq record:
NM_023514.4
NBCI Gene record:
Mrps9 (69527)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023514.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104467 ACTGGCAAACAATCGTACTAT pLKO.1 516 CDS 100% 5.625 7.875 N Mrps9 n/a
2 TRCN0000302541 ACTGGCAAACAATCGTACTAT pLKO_005 516 CDS 100% 5.625 7.875 N Mrps9 n/a
3 TRCN0000104468 GAGGATATTGATAGAGCTATT pLKO.1 363 CDS 100% 10.800 7.560 N Mrps9 n/a
4 TRCN0000302542 GAGGATATTGATAGAGCTATT pLKO_005 363 CDS 100% 10.800 7.560 N Mrps9 n/a
5 TRCN0000104465 GCAGAAGTGTAACTATTCAAT pLKO.1 775 CDS 100% 5.625 3.938 N Mrps9 n/a
6 TRCN0000302618 GCAGAAGTGTAACTATTCAAT pLKO_005 775 CDS 100% 5.625 3.938 N Mrps9 n/a
7 TRCN0000104469 CTGATTAAGGAGGAACTAGAA pLKO.1 639 CDS 100% 4.950 3.465 N Mrps9 n/a
8 TRCN0000104466 CGACGTGTATGGAAAGGTCAT pLKO.1 548 CDS 100% 4.050 2.835 N Mrps9 n/a
9 TRCN0000302540 CGACGTGTATGGAAAGGTCAT pLKO_005 548 CDS 100% 4.050 2.835 N Mrps9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023514.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.