Transcript: Mouse NM_023517.2

Mus musculus tumor necrosis factor (ligand) superfamily, member 13 (Tnfsf13), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Tnfsf13 (69583)
Length:
1679
CDS:
296..1021

Additional Resources:

NCBI RefSeq record:
NM_023517.2
NBCI Gene record:
Tnfsf13 (69583)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023517.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362495 GACTTGTGCTGTCGCACTACT pLKO_005 394 CDS 100% 4.950 6.930 N Tnfsf13 n/a
2 TRCN0000076987 GCACTACTGATCCAACAGACA pLKO.1 407 CDS 100% 2.640 3.696 N Tnfsf13 n/a
3 TRCN0000076984 CGGTTGCTCTTTGGTTGAGTT pLKO.1 351 CDS 100% 4.950 3.465 N Tnfsf13 n/a
4 TRCN0000362494 TCCAACAGACAGAGCTGCAAA pLKO_005 417 CDS 100% 4.950 3.465 N Tnfsf13 n/a
5 TRCN0000362413 CGCACTACTGATCCAACAGAC pLKO_005 406 CDS 100% 4.050 2.835 N Tnfsf13 n/a
6 TRCN0000271940 GCTTTGACTCCATGGATATTA pLKO_005 1157 3UTR 100% 15.000 7.500 Y Tnfsfm13 n/a
7 TRCN0000281903 ATCCTGACCGTGCCTACAATA pLKO_005 876 CDS 100% 13.200 6.600 Y Tnfsfm13 n/a
8 TRCN0000076986 CTGGAATTTATCTGCTCTATA pLKO.1 747 CDS 100% 13.200 6.600 Y Tnfsf13 n/a
9 TRCN0000200536 CTGGAATTTATCTGCTCTATA pLKO.1 747 CDS 100% 13.200 6.600 Y Tnfsfm13 n/a
10 TRCN0000281850 GAAACTCTATTCCGATGTATC pLKO_005 839 CDS 100% 10.800 5.400 Y Tnfsfm13 n/a
11 TRCN0000281849 GATGTGGCAACCAGTACTTAG pLKO_005 676 CDS 100% 10.800 5.400 Y Tnfsfm13 n/a
12 TRCN0000191615 GCTTTCAGTATTTCACCTATT pLKO.1 1397 3UTR 100% 10.800 5.400 Y Tnfsfm13 n/a
13 TRCN0000076985 GCAGGTGTCTTTCATTTACAT pLKO.1 908 CDS 100% 5.625 2.813 Y Tnfsf13 n/a
14 TRCN0000192609 GCAGGTGTCTTTCATTTACAT pLKO.1 908 CDS 100% 5.625 2.813 Y Tnfsfm13 n/a
15 TRCN0000192936 GCGTCCAAATTCTTGTTACTA pLKO.1 1418 3UTR 100% 5.625 2.813 Y Tnfsfm13 n/a
16 TRCN0000076983 TGGCTAGACAAAGGACAAGGA pLKO.1 1060 3UTR 100% 2.640 1.320 Y Tnfsf13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023517.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.