Transcript: Mouse NM_023596.3

Mus musculus solute carrier family 29 (nucleoside transporters), member 3 (Slc29a3), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Slc29a3 (71279)
Length:
5240
CDS:
49..1476

Additional Resources:

NCBI RefSeq record:
NM_023596.3
NBCI Gene record:
Slc29a3 (71279)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023596.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295641 TCGCGTGCATGGCCATCATTA pLKO_005 554 CDS 100% 13.200 18.480 N Slc29a3 n/a
2 TRCN0000295634 CGAATAAGCTGGGCATGTTAG pLKO_005 1948 3UTR 100% 10.800 15.120 N Slc29a3 n/a
3 TRCN0000295633 TGGACATCCTGAACTACTTTG pLKO_005 338 CDS 100% 10.800 7.560 N Slc29a3 n/a
4 TRCN0000079742 AGTGTTGTGATGTTGTTCTAT pLKO.1 1396 CDS 100% 5.625 3.938 N Slc29a3 n/a
5 TRCN0000288302 AGTGTTGTGATGTTGTTCTAT pLKO_005 1396 CDS 100% 5.625 3.938 N Slc29a3 n/a
6 TRCN0000079740 GCCATCTTCGTGGTTATGATT pLKO.1 478 CDS 100% 5.625 3.938 N Slc29a3 n/a
7 TRCN0000079738 CCTCAGCTATTTAGGGAGTTT pLKO.1 2030 3UTR 100% 4.950 3.465 N Slc29a3 n/a
8 TRCN0000079739 CCATCTTCAATAGCAGCGTTT pLKO.1 587 CDS 100% 4.050 2.835 N Slc29a3 n/a
9 TRCN0000288376 CCATCTTCAATAGCAGCGTTT pLKO_005 587 CDS 100% 4.050 2.835 N Slc29a3 n/a
10 TRCN0000079741 CTGGGCATATAAACTCCGAAA pLKO.1 279 CDS 100% 4.050 2.835 N Slc29a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023596.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.