Transcript: Mouse NM_023598.2

Mus musculus AT rich interactive domain 5B (MRF1-like) (Arid5b), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Arid5b (71371)
Length:
4494
CDS:
17..3583

Additional Resources:

NCBI RefSeq record:
NM_023598.2
NBCI Gene record:
Arid5b (71371)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023598.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234130 GGCTTGCACGGACCTTATATT pLKO_005 56 CDS 100% 15.000 21.000 N Arid5b n/a
2 TRCN0000234133 TATCCAGCTCGAAACTTTATT pLKO_005 225 CDS 100% 15.000 21.000 N Arid5b n/a
3 TRCN0000111954 GCCGAAGAATAACCACAATAA pLKO.1 895 CDS 100% 13.200 18.480 N Arid5b n/a
4 TRCN0000234132 TACGCCAAAGGATCCGATTTG pLKO_005 154 CDS 100% 10.800 15.120 N Arid5b n/a
5 TRCN0000365673 TACGCCAAAGGATCCGATTTG pLKO_005 154 CDS 100% 10.800 15.120 N ARID5B n/a
6 TRCN0000218504 GAGAAGATCCACGTCAATTAT pLKO_005 2645 CDS 100% 15.000 12.000 N Arid5b n/a
7 TRCN0000111953 CGTCAGTGGAAACATATTTAT pLKO.1 1133 CDS 100% 15.000 10.500 N Arid5b n/a
8 TRCN0000234131 CTTGAAGGCAAACCAAGAATC pLKO_005 101 CDS 100% 10.800 7.560 N Arid5b n/a
9 TRCN0000111951 GCCCTGTATAAATACATGAAA pLKO.1 998 CDS 100% 5.625 3.938 N Arid5b n/a
10 TRCN0000111950 CCATCCGTAATCCAACATGTT pLKO.1 2261 CDS 100% 4.950 3.465 N Arid5b n/a
11 TRCN0000111952 CCCAAGATACATCTGAGGTTT pLKO.1 1401 CDS 100% 4.950 3.465 N Arid5b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023598.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.