Transcript: Mouse NM_023671.2

Mus musculus chloride channel, nucleotide-sensitive, 1A (Clns1a), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Clns1a (12729)
Length:
3395
CDS:
74..799

Additional Resources:

NCBI RefSeq record:
NM_023671.2
NBCI Gene record:
Clns1a (12729)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023671.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069527 CTGGTTAGATGGTTCGGGATT pLKO.1 223 CDS 100% 4.050 5.670 N Clns1a n/a
2 TRCN0000069526 CCAATATAATATGGCAGGCGT pLKO.1 679 CDS 100% 0.660 0.924 N Clns1a n/a
3 TRCN0000069524 CCTCAAGAGCATTTGTATGTT pLKO.1 308 CDS 100% 5.625 3.938 N Clns1a n/a
4 TRCN0000069523 GATTAGGATTCTCACTGGAAT pLKO.1 240 CDS 100% 4.950 3.465 N Clns1a n/a
5 TRCN0000069525 GCCCAGTGATAAGTCAGCATT pLKO.1 430 CDS 100% 4.950 3.465 N Clns1a n/a
6 TRCN0000005257 GCATTTGTATGTTATGGTGAA pLKO.1 316 CDS 100% 4.050 2.835 N CLNS1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023671.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.