Transcript: Mouse NM_023824.3

Mus musculus progestin and adipoQ receptor family member IV (Paqr4), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Paqr4 (76498)
Length:
2507
CDS:
306..1127

Additional Resources:

NCBI RefSeq record:
NM_023824.3
NBCI Gene record:
Paqr4 (76498)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023824.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124450 GCAGTTCAATAAGTTCGTATT pLKO.1 362 CDS 100% 10.800 15.120 N Paqr4 n/a
2 TRCN0000124453 GCACCTGCAGTTCAATAAGTT pLKO.1 356 CDS 100% 5.625 4.500 N Paqr4 n/a
3 TRCN0000317476 GCACCTGCAGTTCAATAAGTT pLKO_005 356 CDS 100% 5.625 4.500 N Paqr4 n/a
4 TRCN0000313959 CCACAGCTTCCTGGACAAATT pLKO_005 1157 3UTR 100% 13.200 9.240 N Paqr4 n/a
5 TRCN0000313890 GGCTCCTTGCCTTGGATATGT pLKO_005 646 CDS 100% 5.625 3.938 N Paqr4 n/a
6 TRCN0000313889 ACACAACGAGCTGGGCAACAT pLKO_005 440 CDS 100% 4.950 3.465 N Paqr4 n/a
7 TRCN0000124449 GCAACATCAATAAAGGGACAA pLKO.1 1930 3UTR 100% 4.050 2.835 N Paqr4 n/a
8 TRCN0000124451 CTGCAGTTCAATAAGTTCGTA pLKO.1 360 CDS 100% 3.000 2.100 N Paqr4 n/a
9 TRCN0000434881 CAACTCCCACCAGATCATGCA pLKO_005 1016 CDS 100% 2.640 1.848 N PAQR4 n/a
10 TRCN0000124452 CCTTGGATATGTGTGGAGTCT pLKO.1 655 CDS 100% 2.640 1.848 N Paqr4 n/a
11 TRCN0000313960 CTGTGCTGTATCACCTCTTCA pLKO_005 592 CDS 100% 4.950 2.970 N Paqr4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023824.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.