Transcript: Mouse NM_023876.4

Mus musculus elongator acetyltransferase complex subunit 4 (Elp4), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Elp4 (77766)
Length:
6755
CDS:
77..1345

Additional Resources:

NCBI RefSeq record:
NM_023876.4
NBCI Gene record:
Elp4 (77766)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023876.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197746 GCACATCTTGTCCAGAATAAA pLKO.1 983 CDS 100% 15.000 21.000 N Elp4 n/a
2 TRCN0000277256 TCACGATTTGGTCACTATTAT pLKO_005 602 CDS 100% 15.000 21.000 N Elp4 n/a
3 TRCN0000285930 AGTCACCGAGTGCGAAGTTAT pLKO_005 1357 3UTR 100% 13.200 18.480 N Elp4 n/a
4 TRCN0000217613 GAAGATTCCTCGGCTTAATAA pLKO.1 1123 CDS 100% 15.000 12.000 N Elp4 n/a
5 TRCN0000217754 CACATCTCTCCAGATCTTAAA pLKO.1 692 CDS 100% 13.200 9.240 N Elp4 n/a
6 TRCN0000177532 CCTTTCCTTAACATGGGTAAA pLKO.1 3799 3UTR 100% 10.800 7.560 N Elp4 n/a
7 TRCN0000176622 CCTAATGTCAACATGAAGATA pLKO.1 530 CDS 100% 5.625 3.938 N Elp4 n/a
8 TRCN0000277299 CCTAATGTCAACATGAAGATA pLKO_005 530 CDS 100% 5.625 3.938 N Elp4 n/a
9 TRCN0000176444 CTTACCAAGTTCCTCTACATT pLKO.1 911 CDS 100% 5.625 3.938 N Elp4 n/a
10 TRCN0000277255 CTTACCAAGTTCCTCTACATT pLKO_005 911 CDS 100% 5.625 3.938 N Elp4 n/a
11 TRCN0000178441 GAGAGAGACTAACCCATTGTA pLKO.1 1072 CDS 100% 5.625 3.938 N Elp4 n/a
12 TRCN0000277254 GAGAGAGACTAACCCATTGTA pLKO_005 1072 CDS 100% 5.625 3.938 N Elp4 n/a
13 TRCN0000197538 CCCTTGAAATTGAGTGAACAT pLKO.1 3262 3UTR 100% 4.950 3.465 N Elp4 n/a
14 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5522 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023876.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.