Transcript: Mouse NM_024203.3

Mus musculus family with sequence similarity 120, member B (Fam120b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Fam120b (67544)
Length:
4540
CDS:
333..2693

Additional Resources:

NCBI RefSeq record:
NM_024203.3
NBCI Gene record:
Fam120b (67544)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024203.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264502 GCATAGTGGGTTAAGCTTAAA pLKO_005 3734 3UTR 100% 13.200 18.480 N Fam120b n/a
2 TRCN0000264501 GCTACCTAGTGTACAACATTC pLKO_005 1732 CDS 100% 10.800 15.120 N Fam120b n/a
3 TRCN0000192392 CGGCATCAAGTTGATATTCTT pLKO.1 575 CDS 100% 5.625 7.875 N Fam120b n/a
4 TRCN0000264503 CCTAGCTGTCTCAGACTATAT pLKO_005 1124 CDS 100% 13.200 9.240 N Fam120b n/a
5 TRCN0000264500 GCCAGAAGTTTCCCAATATAC pLKO_005 1520 CDS 100% 13.200 9.240 N Fam120b n/a
6 TRCN0000216345 GTACGTCAGTCACAAGTTTAA pLKO.1 4362 3UTR 100% 13.200 9.240 N Fam120b n/a
7 TRCN0000264499 TTCCGAGTCTGAGATCTTAAA pLKO_005 1679 CDS 100% 13.200 9.240 N Fam120b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024203.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.