Transcript: Mouse NM_024210.2

Mus musculus RIKEN cDNA 2310033P09 gene (2310033P09Rik), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
2310033P09Rik (67862)
Length:
1243
CDS:
69..851

Additional Resources:

NCBI RefSeq record:
NM_024210.2
NBCI Gene record:
2310033P09Rik (67862)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024210.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202377 GCGGACAAGACCAGTTCAATT pLKO.1 100 CDS 100% 13.200 18.480 N 2310033P09Rik n/a
2 TRCN0000329594 CGGACAAGACCAGTTCAATTG pLKO_005 101 CDS 100% 10.800 15.120 N 2310033P09Rik n/a
3 TRCN0000329590 TAAGAGGAAGCGGGAACATAG pLKO_005 773 CDS 100% 10.800 8.640 N 2310033P09Rik n/a
4 TRCN0000329591 CGCTATCCCGAGAAGACAAAG pLKO_005 463 CDS 100% 10.800 7.560 N 2310033P09Rik n/a
5 TRCN0000329592 GCCAAGCTTGCTGGATCTTAG pLKO_005 981 3UTR 100% 10.800 7.560 N 2310033P09Rik n/a
6 TRCN0000190737 GATGCAGAGAGCCATAAGAAA pLKO.1 600 CDS 100% 5.625 3.938 N 2310033P09Rik n/a
7 TRCN0000201690 GCTGGATCTTAGGATCTATCT pLKO.1 990 3UTR 100% 4.950 3.465 N 2310033P09Rik n/a
8 TRCN0000201947 CGCACTTGGTTACAAGAACGT pLKO.1 308 CDS 100% 2.640 1.848 N 2310033P09Rik n/a
9 TRCN0000329659 ACCGGATGCAGAGAGCCATAA pLKO_005 596 CDS 100% 10.800 6.480 N 2310033P09Rik n/a
10 TRCN0000200779 GAAGAAACACAAGAAACACAA pLKO.1 647 CDS 100% 4.950 2.970 N 2310033P09Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024210.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.