Transcript: Mouse NM_024243.4

Mus musculus fucosidase, alpha-L- 1, tissue (Fuca1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Fuca1 (71665)
Length:
2523
CDS:
79..1437

Additional Resources:

NCBI RefSeq record:
NM_024243.4
NBCI Gene record:
Fuca1 (71665)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024243.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375244 GCTTACCATCCCTGCAATAAA pLKO_005 1473 3UTR 100% 15.000 21.000 N Fuca1 n/a
2 TRCN0000305242 CTCAACATTGGACCAACTAAA pLKO_005 1045 CDS 100% 13.200 18.480 N Fuca1 n/a
3 TRCN0000111989 CAGAGCTGTATGACCTTGTTA pLKO.1 674 CDS 100% 5.625 3.938 N Fuca1 n/a
4 TRCN0000111988 CCAGAGCTGTATGACCTTGTT pLKO.1 673 CDS 100% 4.950 3.465 N Fuca1 n/a
5 TRCN0000316782 CCAGAGCTGTATGACCTTGTT pLKO_005 673 CDS 100% 4.950 3.465 N Fuca1 n/a
6 TRCN0000111987 GCCACAAAGATAACAATGCTA pLKO.1 1288 CDS 100% 3.000 2.100 N Fuca1 n/a
7 TRCN0000316795 GCCACAAAGATAACAATGCTA pLKO_005 1288 CDS 100% 3.000 2.100 N Fuca1 n/a
8 TRCN0000111985 CCTGATAATGAGCCAAGTCAT pLKO.1 1656 3UTR 100% 4.950 2.970 N Fuca1 n/a
9 TRCN0000111986 CCTGTCAAGGATGAGGTGATA pLKO.1 796 CDS 100% 4.950 2.970 N Fuca1 n/a
10 TRCN0000316851 CCTGTCAAGGATGAGGTGATA pLKO_005 796 CDS 100% 4.950 2.970 N Fuca1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024243.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.